Clonning and characterization of alfa-globulin promoter into an expression vector

The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population...

Full description

Saved in:

Bibliographic Details
Main Author:	Mustafa, Abubakar Sadik
Format:	Thesis
Language:	English
Published:	2013
Subjects:	QK Botany
Online Access:	http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf
Tags:	Add Tag No Tags, Be the first to tag this record!

id	my-utm-ep.36733
record_format	uketd_dc
spelling	my-utm-ep.367332017-09-14T04:23:02Z Clonning and characterization of alfa-globulin promoter into an expression vector 2013-01 Mustafa, Abubakar Sadik QK Botany The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population. The manipulation of targeted gene in endosperm is a reliable tissue for the production of recombinant proteins over other tissues because it is more cost-effective, it is easier to scale-up agricultural yield, provides a larger storage ability and safe long-term storage. However only a few endosperm-specific promoters have been identified. The present research, successfully constructed the recombinant plasmid, pCAMGpro from the expression vector, pCAMBIA1305.2 containing the strong endosperm-specific a-globulin promoter (AsGpro). The AsGpro was successfully amplified from pmCACA:GFP using the forward primer, AsGproF_HindIII (5' CACAAACGTGCAAAAGCTTAATTCG 3') and the reverse primer, AsGproR_BamHI (5' GACGGATCCGAGATTGTAGAAGG 3') at 55°C. The size of the promoter fragment was approximately 848 bp. Sequencing and subsequent bioinformatics analysis, confirmed 98% homology of nucleotides to A. sativa (Glo1) gene, promoter region (Accession number: AY795082.1). This fragment was then cloned into pMR104a to generate the recombinant plasmid pMRGpro. Subsequent cloning of the recombinant cassette into the expression vector, pCAMBIA1305.2 to create the new recombinant plasmid, pCAMGpro was achieved. These finding can be used to genetically modify rice to express high levels of endosperm specific nutritional proteins of interest that would increase food production and help in alleviating the food crisis facing the world. 2013-01 Thesis http://eprints.utm.my/id/eprint/36733/ http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf application/pdf en public masters Universiti Teknologi Malaysia, Faculty of Biosciences and Medical Engineering Faculty of Biosciences and Medical Engineering
institution	Universiti Teknologi Malaysia
collection	UTM Institutional Repository
language	English
topic	QK Botany
spellingShingle	QK Botany Mustafa, Abubakar Sadik Clonning and characterization of alfa-globulin promoter into an expression vector
description	The world population is expected to rise by an addition of 2 billion by 2030 and rice consumers are projected to increase by 1.8% annually. Hence, rice production must be increased between 25-45% to match-up the growing population since it is a staple food to more than half of the world’s population. The manipulation of targeted gene in endosperm is a reliable tissue for the production of recombinant proteins over other tissues because it is more cost-effective, it is easier to scale-up agricultural yield, provides a larger storage ability and safe long-term storage. However only a few endosperm-specific promoters have been identified. The present research, successfully constructed the recombinant plasmid, pCAMGpro from the expression vector, pCAMBIA1305.2 containing the strong endosperm-specific a-globulin promoter (AsGpro). The AsGpro was successfully amplified from pmCACA:GFP using the forward primer, AsGproF_HindIII (5' CACAAACGTGCAAAAGCTTAATTCG 3') and the reverse primer, AsGproR_BamHI (5' GACGGATCCGAGATTGTAGAAGG 3') at 55°C. The size of the promoter fragment was approximately 848 bp. Sequencing and subsequent bioinformatics analysis, confirmed 98% homology of nucleotides to A. sativa (Glo1) gene, promoter region (Accession number: AY795082.1). This fragment was then cloned into pMR104a to generate the recombinant plasmid pMRGpro. Subsequent cloning of the recombinant cassette into the expression vector, pCAMBIA1305.2 to create the new recombinant plasmid, pCAMGpro was achieved. These finding can be used to genetically modify rice to express high levels of endosperm specific nutritional proteins of interest that would increase food production and help in alleviating the food crisis facing the world.
format	Thesis
qualification_level	Master's degree
author	Mustafa, Abubakar Sadik
author_facet	Mustafa, Abubakar Sadik
author_sort	Mustafa, Abubakar Sadik
title	Clonning and characterization of alfa-globulin promoter into an expression vector
title_short	Clonning and characterization of alfa-globulin promoter into an expression vector
title_full	Clonning and characterization of alfa-globulin promoter into an expression vector
title_fullStr	Clonning and characterization of alfa-globulin promoter into an expression vector
title_full_unstemmed	Clonning and characterization of alfa-globulin promoter into an expression vector
title_sort	clonning and characterization of alfa-globulin promoter into an expression vector
granting_institution	Universiti Teknologi Malaysia, Faculty of Biosciences and Medical Engineering
granting_department	Faculty of Biosciences and Medical Engineering
publishDate	2013
url	http://eprints.utm.my/id/eprint/36733/1/AbubakarSadikMustafaMFBSK2013.pdf
_version_	1747816451671064576

Clonning and characterization of alfa-globulin promoter into an expression vector

Similar Items